Answers
Answer: Diabetes is a condition where blood sugar levels are higher than normal and the discharge teaching will provided to a patient who has diabetes and smokes as well is that patient should quit smoking as soon as possible as smoking adverse the condition of diabetes. The medicines should be taken on time and should not smoke at the same time because the tobacco may decrease the effect of the medicines. He should include physical activities in daily routine.
Smoking and poor self-management of diabetes can increase the risk of long-term complications as smokers are at greater risk of developing diabetes as compared to non-smokers. Diabetic patient along who smoke are prone to many of the diseases such as heart and kindey disease, poor blood flow to the lungs which leads to infection, cancer, an eye disease such as retinopathy. etc.
.Similar Solved Questions
1 answer
Please be as descriptive as you can In Chapter 3, we have studied techniques for solving...
Please be as descriptive as you can In Chapter 3, we have studied techniques for solving linear systems. Given the coeffi- cient matrix for the system, we can use these techniques to classify the system, describe the qualitative behavior of solutions, and give a formula for the general solution. In...
1 answer
1. Create the primers to amplify the gene of interest. 1. Below is almost the full...
1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Desig...
1 answer
2. A. Draw the scatter plot and compute the predicted equation of the line using the...
2. A. Draw the scatter plot and compute the predicted equation of the line using the least square Regression line method. Show all the steps, do not just write the answer. X 0 1 3 4 7 Y 7 5 4 3 2...
1 answer
My question is who would I put as the payee for the check for this part...
My question is who would I put as the payee for the check for this part in my text book. It says wrote check number 10010 to City Credit Union for payment of amount due (City Credit Union in the Account/Category field: $110.35....
1 answer
Can you please help me answer this questions and explain the answer? The Kcat of an...
Can you please help me answer this questions and explain the answer? The Kcat of an enzyme catalyzed run describes: a) always the last step b) rate limiting step c) fastest step...
1 answer
Define a class DoubleStack which implements two stacks of objects of type Object using a single...
Define a class DoubleStack which implements two stacks of objects of type Object using a single shared array, so that the push and pop operations specify which of the two stacks is involved in the operation (as described below). (a) Specify necessary instance variables and write a constructor &ldquo...
1 answer
In an experiment on the conservation of angular momentum, a student needs to find the angular...
In an experiment on the conservation of angular momentum, a student needs to find the angular momentum L of a uniform disk of mass M and radius R as it rotates with angular velocity . She makes the following measurements: ? = 1.10 ± 0.01 ?? ? = 0.250 ± 0.005 ? ? = 21.5 ±...
1 answer
What have been the most effective efforts against drug cartels?
What have been the most effective efforts against drug cartels?...
1 answer
(20 pts total) The diagram shows the electric fieldlines for a system of three point charges,...
(20 pts total) The diagram shows the electric fieldlines for a system of three point charges, indicated by the circles numbered 1, 2, and 3. 6. a. (5pts) Which point charge(s) is/are positive? b, (5pts) which point charge has more charge, #2 or #3? c. (5pts) Which spot has a larger magnitude electri...
1 answer
1) a) Merchandise Inventory. 10/31/2017 b) Accrued interest on Notes Receivable c) Unexpired Store Rent d)...
1) a) Merchandise Inventory. 10/31/2017 b) Accrued interest on Notes Receivable c) Unexpired Store Rent d) Depreciation on Equipment e) Accrued interest on Notes Payable f) Accrued Office Salaries g) Store Supplies on hand h) Bad debts is based on the aging of Accounts Receivable i) Expired Insuranc...
1 answer
A horizontal length of current-carrying wire is suspended from two identical flexible leads that are under...
A horizontal length of current-carrying wire is suspended from two identical flexible leads that are under tension due to the weight of the wire. The wire is oriented at right angles to a uniform magnetic field that has a magnitude of 4 T and is directed out of the screen of the figure. The length L...
1 answer
5 . (20 points) Tidal height. At static equilibrium, the surface of the ocean is an...
5 . (20 points) Tidal height. At static equilibrium, the surface of the ocean is an equi-potential surface because fluid cannot sustain a shear (lateral) force. Taylor computed the difference in tidal height between point P and point Q (Fig. 94) by equating the potential energy at P and Q. Apply the...
1 answer
To examine the differences between salaries of male and female middle managers of a large bank, 90 individuals were randomly selected, and two models were created with the following variables cons...
To examine the differences between salaries of male and female middle managers of a large bank, 90 individuals were randomly selected, and two models were created with the following variables considered Salary- the monthly salary (excluding fringe benefits and bonuses), Educ the number of years of e...
1 answer
The diffusion coefficient, D, of a rigid spherical molecule is given by the equation KT Dua 6 where n is the viscos...
The diffusion coefficient, D, of a rigid spherical molecule is given by the equation KT Dua 6 where n is the viscosity of the solvent, r is the radius of the sphere, k is the Boltzman constant 1.38 x 10-6 erg.K-, and T is the absolute temperature in kelvins. Assume that this protein is an unhydrated...
1 answer
Assignment: Access the BLAST site at www.ncbi.nlm.nih.gov/BLAST.cgi Click on “Nucleotide Blast” Enter the following sequence: ACATTTGCTTCTGACACAATTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTG
Assignment: Access the BLAST site at www.ncbi.nlm.nih.gov/BLAST.cgi Click on “Nucleotide Blast” Enter the following sequence: ACATTTGCTTCTGACACAATTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG GCCCTGGGCAG 23. USING THE SAME...
1 answer
The 2021 income statement for Anderson TV and Appliance reported net sales of $360,000 and net...
The 2021 income statement for Anderson TV and Appliance reported net sales of $360,000 and net income of $85,000. Average total assets for 2021 was $800,000. Shareholders’ equity at the beginning of the year was $500,000 and $40,000 was paid to shareholders as dividends. There were no other sh...
1 answer
How do you balance and translate this reaction: #Cu(s) + AgNO_3(aq) -> Cu(NO_3)_2(l) + Ag(s)#?
How do you balance and translate this reaction: #Cu(s) + AgNO_3(aq) -> Cu(NO_3)_2(l) + Ag(s)#?...