1 answer

The balance sheet of a sole trader revealed the following position.

Question:

Fixed Assets

Land and buildings

R

9 170

R

Equipment at cost less depreciation 15 570

Goodwill at cost less amounts written off 10 250 34 990

Investment in shares at cost 2 200

Current Assets

R

R

Trading stock

45 840

Sundry debtors less bad debts written off

19 350

Cash at bank

10 920

76 110

113 300

=

A

Less: Current Liabilities

R

Sundry creditors and accruals

77 600

=

L

35 700

Owner's Interest

R

R

Capital

28 400

Profit for the year

7 300

35 700

=

0

Required

Answer the following questions:

(a) Are the assets correctly classified? If not, re-arrange them and give your reasons for doing this.

(b) What is the current ratio? Is it satisfactory?

(c) What is the acid-test ratio? Is it satisfactory?

(d) Is the business solvent? Give your reasons.

(e) Is the business overtrading? Give your reasons.

(f) What is the profitability ratio of the business?


Answers

Sole Trader
Answer a
Classified Balance Sheet
AssetsAmount $
Current Assets
Cash     10,920.00
Account Receivable Net     19,350.00
Trading Stock     45,840.00
Current Assets    76,110.00
Long Term Investments
Investment in shares       2,200.00
Long Term Investments       2,200.00
Property, plant, and equipment
Land and Building       9,170.00
Equipment (net)     15,570.00
Total Property, plant, and equipment    24,740.00
Intangible assets
Goodwill     10,250.00
Intangible assets    10,250.00
Total Assets113,300.00


Liabilities & Owners' Equity
Current Liabilities
Sundry creditors and accruals     77,600.00
Current Liabilities    77,600.00
Long Term Liabilities


Total Long Term Liabilities                   -  
Total Liabilities    77,600.00
Owners' Equity
Capital     28,400.00
Profit for the year       7,300.00
Total Owners' Equity    35,700.00
Total Liabilities & Owners' Equity113,300.00


Quick Assets2019
Current Assets     76,110.00
Less:
Trading Stock     45,840.00
Quick Assets    30,270.00


Ans b
Current Ratio               0.98
Current Assets/Current Liabilities
Current ratio is less than 1 so it is not satisfactory.


Ans c
Quick Ratio               0.39
Quick Assets/Current Liabilities
Quick ratio is less than 1 so it is not satisfactory.


Ans d
Working capital is used to determine if business is overtrading.
Working Capital     (1,490.00)
Current Assets less Current Liabilities
As Working capital is negative so the business is overtrading.


Ans e
Profitability ratio
Profitability margin25.70%
Profit for the year/Capital
So Profitability ratio is 25.70%


.

Similar Solved Questions

1 answer
Ndaoneea..DSB.-. an
ndaoneea..DSB.-. an...
1 answer
What are the products of #HOH + TiO_2 ->#?
What are the products of #HOH + TiO_2 ->#?...
1 answer
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence....
1 answer
Answer all parts estion 19 - Part A - Determine if the following reaction will undergo...
answer all parts estion 19 - Part A - Determine if the following reaction will undergo SN1, SN2, E1, and/or E2 mechanisms. HO SN1 SN2 E1 E2 Submit Request Answer Part B.Draw all possible products formed. Take note of possible rearrangement. © ®, H 120 r...
1 answer
(20 points) Suppose honey is produced in a beehive using bees and sugar.  Each honey producer uses...
(20 points) Suppose honey is produced in a beehive using bees and sugar.  Each honey producer uses one beehive which she rents for $40/month. Producing q gallons of honey in one month requires spending 4q dollars bees, and 2q2dollars on sugar. a) (4 points) What is the total cost of produc...
1 answer
The Supreme Court in In re Quinlan discussed Karen’s right to privacy at length. What documents...
The Supreme Court in In re Quinlan discussed Karen’s right to privacy at length. What documents and precedent did the Court look to in order to establish Karen’s legal right to privacy? How did the Court evaluate the interests of the state in light of Karen’s right to privacy? Beca...
1 answer
You are a choreographer putting together a dance number where the dancers will dance in pairs. Each dancer i has a height hi and you can only pair up dancers if the difference between their heights i...
You are a choreographer putting together a dance number where the dancers will dance in pairs. Each dancer i has a height hi and you can only pair up dancers if the difference between their heights is at most H. You wish, given this constraint, to find the maximal number of suitable pairs. Describe ...
1 answer
B) Two bar magnets with their north poles having strength Qml=20 A.m and Qm2=10A.m are placed...
b) Two bar magnets with their north poles having strength Qml=20 A.m and Qm2=10A.m are placed inside a volume as shown. Calculate the magnetic flux, y leaving the volume...
1 answer
Based on the solution concentrations we will be using in lab (0.10 M, 0.30 M, 1.0...
Based on the solution concentrations we will be using in lab (0.10 M, 0.30 M, 1.0 M, and 3.0 M copper (II) nitrate solution and 1.0 M zinc (II) nitrate AND 50 mL 1.0 M potassium nitrate), calculate the theoretical Ecell values and plot a calibration curve using Excel. Include the equation for the ca...
1 answer
QUESTION 15 Suppose that a hypothesis test is conducted to test the null hypothesis, Ho: P,...
QUESTION 15 Suppose that a hypothesis test is conducted to test the null hypothesis, Ho: P, P2, using the sample data shown. Sample 1 n1 200 Xy 11 Sample 2 n2=100 X2= 8 Find the p-value for the test. 4020 .1011 0201 .0012 Click Save and Submit to saue and submit. Click Save All Answers to sae all an...
1 answer
Current Status A.B. is a married, 47-year-old white female homemaker with two children and an 18-year...
Current Status A.B. is a married, 47-year-old white female homemaker with two children and an 18-year medical history of systemic lupus erythematosus. She has no known allergies. The patient takes an occasional naproxen for joint pain and antacid for heartburn but no other prescription or OTC medica...
1 answer
*Again-Rules for rounding: If you are calculating in tablets, always round to the nearest 1/2 tablet....
*Again-Rules for rounding: If you are calculating in tablets, always round to the nearest 1/2 tablet. When you are calculating IV' rates, round to the nearest whole number. Perform rounding only the end of the calculation CONVERSTIONS TO USE 1 grain =60 mg 15 grain=1 gram 1 pint= 2 cups=480mL...
2 answers
How do you solve #\frac{15}{2}=-1x+7#?
How do you solve #\frac{15}{2}=-1x+7#?...
1 answer
REP (L/A); R = Ro (1+AAT); Ohm's Law: AV = IR: Area of a circler?:p -...
REP (L/A); R = Ro (1+AAT); Ohm's Law: AV = IR: Area of a circler?:p - Po (1 + QAT); Fe =qvB sine ;FgqvB; F. (mv)/r; B - Mol/127V): 40 - 4m x 10 T.m/A; Series: Rnet = R1 + R2 + R3; Parallel: Rnet = ((1/R1) +(1/R2) + (1/R3)) ? : You are working in lab was given a task by your supervisor to determi...
1 answer
What are single bonds?
What are single bonds?...
1 answer
Land was purchased for $150,000 and placed in service during the current year. Taxable income before...
Land was purchased for $150,000 and placed in service during the current year. Taxable income before the 179 deduction was $300,000. Indicate the amount of a deduction under the Section 179 election a $150,000 $300,000 b. $30,000 d. No 179 election is allowed....
1 answer
1. You have $49,061.69 in a brokerage account, and you plan to deposit an additional $5,000...
1. You have $49,061.69 in a brokerage account, and you plan to deposit an additional $5,000 at the end of every future year until your account totals $200,000. You expect to earn 9.1% annually on the account. How many years will it take to reach your goal? Round your answer to the nearest whole numb...
1 answer
These selected condensed data are taken from a recent balance sheet of Sheridan Company (in millions...
These selected condensed data are taken from a recent balance sheet of Sheridan Company (in millions of dollars). $9.0 19.7 Cash Accounts receivable Inventory Other current assets Total current liabilities 18.0 11.8 $26.0 Additional information: Current liabilities at the beginning of the year were ...
1 answer
PLEASE READ CAREFULLY AND ALL THE WAY THROUGH!!! I already asked this question but unfortunately the...
PLEASE READ CAREFULLY AND ALL THE WAY THROUGH!!! I already asked this question but unfortunately the person who answered it did not read it. There is a sorting algorithm, “Stooge-Sort” which is named after the comedy team, "The Three Stooges." if the input size, n, is 1or 2, then...