2 answers

Solve using the quadratic formula

Question:

Solve using the quadratic formula.
5x^2-2x-3=0

Answers

Ok, remember that the quadratic formula is (-b+-sqrt(b^2 -4ac))/2a : so (2+-sqrt(4+60))/10. So that equals (2+-8)/10.  So you have two answers (2+8)/10 or (2-8)/10. 1 or -6/10.

.

{{{5x^2-3x-3=0}}} Start with the given equation. Notice that the quadratic {{{5x^2-3x-3}}} is in the form of {{{Ax^2+Bx+C}}} where {{{A=5}}}, {{{B=-3}}}, and {{{C=-3}}} Let's use the quadratic formula to solve for "x": {{{x = (-B +- sqrt( B^2-4AC ))/(2A)}}} Start with the quadratic formula {{{x = (-(-3) +- sqrt( (-3)^2-4(5)(-3) ))/(2(5))}}} Plug in {{{A=5}}}, {{{B=-3}}}, and {{{C=-3}}} {{{x = (3 +- sqrt( (-3)^2-4(5)(-3) ))/(2(5))}}} Negate {{{-3}}} to get {{{3}}}. {{{x = (3 +- sqrt( 9-4(5)(-3) ))/(2(5))}}} Square {{{-3}}} to get {{{9}}}. {{{x = (3 +- sqrt( 9--60 ))/(2(5))}}} Multiply {{{4(5)(-3)}}} to get {{{-60}}} {{{x = (3 +- sqrt( 9+60 ))/(2(5))}}} Rewrite {{{sqrt(9--60)}}} as {{{sqrt(9+60)}}} {{{x = (3 +- sqrt( 69 ))/(2(5))}}} Add {{{9}}} to {{{60}}} to get {{{69}}} {{{x = (3 +- sqrt( 69 ))/(10)}}} Multiply {{{2}}} and {{{5}}} to get {{{10}}}. {{{x = (3+sqrt(69))/(10)}}} or {{{x = (3-sqrt(69))/(10)}}} Break up the expression.

So the solutions are {{{x = (3+sqrt(69))/(10)}}} or {{{x = (3-sqrt(69))/(10)}}} which approximate to {{{x=1.131}}} or {{{x=-0.531}}}

.

Similar Solved Questions

1 answer
What is the product of 5’2 and 2?
What is the product of 5’2 and 2?...
1 answer
Question #51 Under the perlodic Inventory method, If ending Inventory is understated, then assets will be...
question #51 Under the perlodic Inventory method, If ending Inventory is understated, then assets will be overstated. True or False True False...
1 answer
You have a portfolio with a beta of 1.20. What will be the new portfolio beta...
You have a portfolio with a beta of 1.20. What will be the new portfolio beta if you keep 87 percent of y money in the old portfolio and 13 percent in a stock with a beta of 0.66? (Do not round intermedia calculations. Round your final answer to 2 decimal places.) New portfolio beta...
1 answer
A water balloon is launched at a speed of 34.0 m/s and an angle of 36...
A water balloon is launched at a speed of 34.0 m/s and an angle of 36 degrees above the horizontal. The water balloon hits a tall building located 23.0 m from the launch pad. At what height above the ground level will the water balloon hit the building? Calculate the answer in meters (m) and rounded...
1 answer
Calculate the binding energy of the deuteron in with mass 2.0141017780 u? (where the My or...
Calculate the binding energy of the deuteron in with mass 2.0141017780 u? (where the My or Mp+1007825 u, M1008665 u, and -931.5 MeV/u). 545.766 eV 765 765 Kev 941.7961 MeV 856.765 GeV...
1 answer
How do you find out the mass of 6 billion dust particles, if a dust particle has a mass of #7.53 xx 10^-10# g?
How do you find out the mass of 6 billion dust particles, if a dust particle has a mass of #7.53 xx 10^-10# g?...
1 answer
How many positive integers less than 2014 such that the sum of the digits of each is a multiple of 5?
How many positive integers less than 2014 such that the sum of the digits of each is a multiple of 5?...
1 answer
Amniotic fluid should be transported to the laboratory; A by routine transport B at 37 degrees...
Amniotic fluid should be transported to the laboratory; A by routine transport B at 37 degrees C protected from light D on dry ice...
1 answer
Question 22 Not yet answered Yang Manufacturing, which uses the high-low method, makes a product called...
Question 22 Not yet answered Yang Manufacturing, which uses the high-low method, makes a product called Yin. The company incurs three different cost types (A, B, and and has a relevant range of operation between 2,500 units and 10,000 units per month. Per unit costs at two different activity levels ...
1 answer
Question. 1) 1) Tf a firm's cash coverage ratio is greater than its times interest earned...
question. 1) 1) Tf a firm's cash coverage ratio is greater than its times interest earned ratio, then the: A) firm has a high degree of liquidity. B) firm has no lease obligations. C) firm's assets are not fully depreciated. D) firm has very little long-term debt....
1 answer
Prepare the following Prolog code. Create a min function that finds the minimum element in a...
Prepare the following Prolog code. Create a min function that finds the minimum element in a list, i.e. min(X,L) is true when X is the minimum element of the list L 1. Example: | ? min (10, [1,2,3,4,5]). no | ?- min (1, [1,2,31). true ? yes | ?- min (X, [2,5,1,4,21) x 1?...
1 answer
B. Two distinguishable monatomic ideal gases A and B are held in a volume V by...
B. Two distinguishable monatomic ideal gases A and B are held in a volume V by a movable partition of zero weight and volume. The relative proportions of A and B are arbitrary as the system is in equilibrium (i.e., the pressure P and temperature T are uniform throughout the system). Let N = N , +N b...
1 answer
Angelina received $20,000 of qualified dividends this year. Under what circumstances would all $20,000 of the...
Angelina received $20,000 of qualified dividends this year. Under what circumstances would all $20,000 of the dividends be taxed at the same rate? Be specific in your answer. Under what circumstances would the $20,000 of dividends NOT be taxed at the same rate? Be specific in your an...
1 answer
4 (2pts) Your sequence of DNA is S CGTTACACOTGGACTGAGGATGTAGCCAT 3". What is the sequence of the...
4 (2pts) Your sequence of DNA is S CGTTACACOTGGACTGAGGATGTAGCCAT 3". What is the sequence of the longest peptide that can be produced from this doublestranded template? The labeled base is mutated from a G to T. What is the result of this change?...
1 answer
Draw and label a supply and demand for money graph. Now assume that RGDP increases. Show...
Draw and label a supply and demand for money graph. Now assume that RGDP increases. Show this change on the graph. What options would be available to keep interest rates stable?...
1 answer
(a) Determine the Fourier transform of x(t) 26(t-1)-6(t-3) (b) Compute the convolution sum of the following signals, (6%) [696] (c) The Fourier transform of a continuous-time signal a(t) is given bel...
(a) Determine the Fourier transform of x(t) 26(t-1)-6(t-3) (b) Compute the convolution sum of the following signals, (6%) [696] (c) The Fourier transform of a continuous-time signal a(t) is given below. Determine the [696] total energy of (t) 4 sin w (d) Determine the DC value and the average power ...
1 answer
Within a patient care setting, it is common to see nurses, physicians, pharmacists, physical therapists, and...
Within a patient care setting, it is common to see nurses, physicians, pharmacists, physical therapists, and nutritionists working in silos. From the patient’s standpoint, there are multiple people coming into the room throughout the hospital stay, and often they give differing, sometimes conf...