1 answer

Prove that: A line passing through the midpoints of two sides of a triangle is parallel...

Question:

Prove that:

A line passing through the midpoints of two sides of a triangle is parallel to and half the length of the third side of the triangle.


Answers

(11 Let un consider triangle PQR het X and Y bemid point of P Q and PR respectively P Y IM Q construction: Draw RM parallel tWKT PQ 11 MR From 1 and ② The Quadnilateral XM RQ in parallelogram, itora XQ = MR XQ IIMR i XM II QR Lopp niden ol parellelo

The proof for the above question can be found in the attached image.Please go through AAS congruent rule before analysing the proof

(Note - the figure is roughly drawn,kindly dont worry about its measurement)

.

Similar Solved Questions

1 answer
MME 223: Engineering Materials Practice/Example Problems for Chapter 4 Calculate the number of vacancies in aluminum...
MME 223: Engineering Materials Practice/Example Problems for Chapter 4 Calculate the number of vacancies in aluminum at room temperature (25°C) and at its melting temperature. Assume that the energy required to produce 1 mole of vacancies is 80 kJ. Recall that R 8.314 J/mol K...
1 answer
An equilateral triangle is circumscribed inside a circle with a radius of 6. What is the area of the triangle?
An equilateral triangle is circumscribed inside a circle with a radius of 6. What is the area of the triangle?...
1 answer
1. True or False: Managerial decisions based on activity-based costing (ABC) information affect only volume-level, batch-level,...
1. True or False: Managerial decisions based on activity-based costing (ABC) information affect only volume-level, batch-level, and product-level costs. 2. True or False: A cost of quality system is based on the trade-off between incurring costs to meet product (or service) specifications and the co...
1 answer
View Policies Current Attempt in Progress Acompound shaft consists of two pipe segments. Segment (1) has...
View Policies Current Attempt in Progress Acompound shaft consists of two pipe segments. Segment (1) has an outside diameter of 6.50 in, and a wall thickness of 0.375 in. Segment (2) has an outside diameter of 4.50 in and a wall thickness of 0.50 in. The shaft is subjected to an axial compression lo...
1 answer
After reading all the available information carefully, prepare a two page (double-spaced) essay and answer the...
After reading all the available information carefully, prepare a two page (double-spaced) essay and answer the following questions: Assume that we have the following data: C=100+0.50Y Ip=100-20r Mt=0.10Y Ms=100-10r M=80 a. Build the IS-LM function. b. If we assume an increase in Investments by 100 u...
1 answer
A series RLC circuit has a capacitor with a capacitance of 25.0 pF, an inductor with...
A series RLC circuit has a capacitor with a capacitance of 25.0 pF, an inductor with an inductance of 1.10 H and a resistor with a resistance of 68.0 2. The circuit is attached to a source that has a rms voltage of 58.0 V and a frequency of 75.0 Hz. What is the phase angle?...
1 answer
Cal Quantities ve RUC) s Law ircuit Analysis ircuits es and > Moving to another question...
cal Quantities ve RUC) s Law ircuit Analysis ircuits es and > Moving to another question will save this response. Question 30 In the circuit shown below, the equivalent resistor seen by the source is R1 3 k2 cticals Material ew rials 18.0, 1.7 O 10 O 2 er Δ Moving to another question will s...
1 answer
IV. Design of a four bar mechanism (ABCD) according to the following 3 positons (Fig.5), find...
IV. Design of a four bar mechanism (ABCD) according to the following 3 positons (Fig.5), find pressure angle and transmission angle. (15 points) Points Reviewer 1 is known, B B2 BO Fig.5...
1 answer
Identify whether each of the following is a positive or negative externality. Explain your answer. 1....
Identify whether each of the following is a positive or negative externality. Explain your answer. 1. Restoring the Amazon forest can reduce global levels of pollution. 2. Building a nuclear power plant near a housing development. 3. Expanding commuter train service into the suburbs. 4. US exports o...
1 answer
A Uabe X2 X? A Aa .A. E E 3 4 + Z 2 , $...
A Uabe X2 X? A Aa .A. E E 3 4 + Z 2 , $ mep up-to-date with security updates, fixes, and improvements, choose Check for Updates. 4. Page 153 , Problem 4-61 Determine the magnitude of the moment of the force F = 1251 - 10j - 40k) N about the base line AB of the tripod. 211 Words English (US)...
1 answer
Question 2 (10 points) If 25.0 mL of 0.451 M NaOH solution is titrated with 0.253...
Question 2 (10 points) If 25.0 mL of 0.451 M NaOH solution is titrated with 0.253 MH2SO4, the flask at the endpoint will contain (besides the indicator phenolphthalein) as the principal components: sodium hydroxide, sulfuric acid, and water dissolved sodium sulfate and water sodium hydroxide, sodium...
1 answer
The two forces of magnitude F 30 kN form a couple. Choose B as the moment...
The two forces of magnitude F 30 kN form a couple. Choose B as the moment center. The moment of a couple is the same -F 1.2 m about any point. Determine the corresponding couple-vector....
1 answer
5*) Find the angular velocity of the Earth due to its daily rotation and express it...
5*) Find the angular velocity of the Earth due to its daily rotation and express it in radians per second. Then use it, and a model of the Earth as a solid sphere of mass M= 5.97 × 1024 kg and radius R = 6.37 × 106 m, to estimate the angular momentum of the Earth due to its rotation arou...
1 answer
The reactant concentration in a zero-order reaction was 0.100 M after 105 s and 2.00×10−2 M...
The reactant concentration in a zero-order reaction was 0.100 M after 105 s and 2.00×10−2 M after 375 s . What is the rate constant for this reaction?...
1 answer
Radiation Dose
Jack was exposed to fast neutrons; he received a radiation dose of 300 rem on part of his hand, affecting 30.0 grams of tissue. The relative biological effectiveness(RBE) of these neutrons is 11.0.Part A.) How much radiation did Jack recieve (in rad)?Part B.) What was the total energy of the radiati...
1 answer
How do you integrate #int xsin2x# by integration by parts method?
How do you integrate #int xsin2x# by integration by parts method?...
1 answer
Assignment: Access the BLAST site at www.ncbi.nlm.nih.gov/BLAST.cgi Click on “Nucleotide Blast” Enter the following sequence: ACATTTGCTTCTGACACAATTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTG
Assignment: Access the BLAST site at www.ncbi.nlm.nih.gov/BLAST.cgi Click on “Nucleotide Blast” Enter the following sequence: ACATTTGCTTCTGACACAATTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAG GCCCTGGGCAG 23. USING THE SAME...
1 answer
Please comment code with steps Solution of the Example Calculate Mean: Standard Deviation: S-- Σ(xi-x) Find...
Please comment code with steps Solution of the Example Calculate Mean: Standard Deviation: S-- Σ(xi-x) Find the t-score: If it is 95% confidence limit (α-0.05), you can use the above Table For any other α values, use the online t-score calculator (http://stattrek.com/online-calcula...