Please open and enlarge Blue box data includedDecision 1 options accept the special sale order or...

Question

Please open and enlarge Blue box data included Suppose the Hockey Hall of Fame in Toronto has approached Star-Cardz with a special order. The Hall of Fame wants to purchase Requirement 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star-Cardz must spend $5,100 to develop Decision 1 options accept the special sale order or reject the special sale order

Decison 2 options accept the special sale order or reject the special sale order

please open it's an attachment

Suppose the Hockey Hall of Fame in Toronto has approached Star-Cardz with a special order. The Hall of Fame wants to purchase 58,000 hockey card packs for a special promotional campaign and offers $0.36 per pack, a total of $20,880. Star - Cardz's total production cost is $0.56 per pack, as follows: E (Click the icon to view the cost information.) Star-Cardz has enough excess capacity to handle the special order. Requirements 1. Prepare an incremental analysis to determine whether Star - Cardz should accept the special sales order assuming fixed costs would not be affected by the special order. 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star - Cardz must spend $5,100 to develop this hologram, which will be useless after the special order is completed. Should Star - Cardz accept the special order under these circumstances? Show your analysis. Requirement 1. Prepare an incremental analysis to determine whether Star - Cardz should accept the special sales order assuming fixed costs would not be affected by the special order. (Enter a zero in an input box if there is no expected change in the expense. Use parentheses or a minus sign for an expected decrease in operating income.) Х Data Table Star-Cardz Incremental Analysis of Special Sales Order Expected increase in revenues Expected increase in expenses: Variable manufacturing cost: Fixed manufacturing costs Total expected increase in expenses S Variable costs Direct materials Direct labour Variable overhead Fixed overhead. 0.13 0.06 0.12 0.25 Expected increase (decrease) in operating income Decision 0.56 Total cost Requirement 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star-Cardz must spend $5,100 to develop this hologram, which Incremental analysis to determine

Requirement 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star-Cardz must spend $5,100 to develop this hologram, which will be useless after the special order is completed. Prepare an incremental analysis to determine whether Star - Cardz should accept the special order under these circumstances. (Enter a zero in an input box if there is no expected change in the expense. Use parentheses or a minus sign for an expected decrease in operating income.) Star-Cardz Incremental Analysis of Special Sales Order Expected increase in revenues Expected increase in expenses: Variable manufacturing cost Fixed manufacturing costs Total expected increase in expenses Expected increase (decrease) in operating income Decision: Enter any number in the edit fields and then continue to the next question

 · Answer

The following table contains required computations in the specified format:  1 $ 20,880 Star-Cardsz Incremental analysis of Special Sales Order Expected increase in revenues Expected increase in expenses: Variable manufacturing cost [(0.13+0.06+0.12)*58,000) $ 17,980 Fixed manufacturing cost $ Total expected increase in expenses Expected increase (decrease ) in operating income Decision: Accept the special offer $ 17,980 $ 2,900 2 $ 20,880 Star-Cardsz Incremental analysis of Special Sales Order Expected increase in revenues Expected increase in expenses: Variable manufacturing cost [(0.13+0.06+0.12)*58,000 $ 17,980 Fixed manufacturing cost $ 5,100 Total expected increase in expenses Expected increase (decrease ) in operating income Decision: Reject the special offer $ 23,080 $ (2,200) .

Please open and enlarge Blue box data includedDecision 1 options accept the special sale order or...

Question:

Answers

Similar Solved Questions

Cam ABC is supported by a post at B. The coefficient of static friction between the...

Consider the following hypotheses: H0: μ = 19 HA: μ ≠ 19 The population is normally...

The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...

STEEL 2. Figure (b) shows a bolt under tension (M20x2.5). The property class of the bolt...

Calculate the (a) current flowing in the circuit below and (b) voltage drop across the resistor...

(1) Evaluate the integral. (Hint: Substitution Rule) (2.1 + 3)(2x + 6x + 1)*der

Find the present value of $11,000 if the interest paid is at a rate of 10%...

A sensor about the pivot axis O measures a resulting moment of 41 N.m, what is...

An example of a nonspontaneous process with negative ∆H0 and negative ∆S0 would be a. H2O(g)...

Sports sales for Hype Sports Inc. is a retailer of clothing and sports equipment. The following...

How do you multiply #(5x+9)(2x-3)#?

AM radio signals broadcast electromagnetic radiation at frequencies between 530 kHz and 1.10 MHz. (a) What is the shorte...

Organic chemistry help *) Please mirror the molecule A along the mirror plane given. Homework 1 on chirality b.) Loo...

Emma's On-the-Go, a large convenience store that makes a good deal of money from magazine sales,...

How many liters of NH3 (measured at stp) can be produced by reacting 8.45 Liters (stp)...

Please answer the following question. ACCT-212 Assignment #2 Answer True or False for the following: Actual...

The debits to Work in Process—Roasting Department for Morning Brew Coffee Company for August, together with information...