1 answer

Please open and enlarge Blue box data includedDecision 1 options accept the special sale order or...

Question:

Please open and enlarge Blue box data includedSuppose the Hockey Hall of Fame in Toronto has approached Star-Cardz with a special order. The Hall of Fame wants to purchaseRequirement 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star-Cardz must spend $5,100 to developDecision 1 options accept the special sale order or reject the special sale order

Decison 2 options accept the special sale order or reject the special sale order

please open it's an attachment

Suppose the Hockey Hall of Fame in Toronto has approached Star-Cardz with a special order. The Hall of Fame wants to purchase 58,000 hockey card packs for a special promotional campaign and offers $0.36 per pack, a total of $20,880. Star - Cardz's total production cost is $0.56 per pack, as follows: E (Click the icon to view the cost information.) Star-Cardz has enough excess capacity to handle the special order. Requirements 1. Prepare an incremental analysis to determine whether Star - Cardz should accept the special sales order assuming fixed costs would not be affected by the special order. 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star - Cardz must spend $5,100 to develop this hologram, which will be useless after the special order is completed. Should Star - Cardz accept the special order under these circumstances? Show your analysis. Requirement 1. Prepare an incremental analysis to determine whether Star - Cardz should accept the special sales order assuming fixed costs would not be affected by the special order. (Enter a zero in an input box if there is no expected change in the expense. Use parentheses or a minus sign for an expected decrease in operating income.) Х Data Table Star-Cardz Incremental Analysis of Special Sales Order Expected increase in revenues Expected increase in expenses: Variable manufacturing cost: Fixed manufacturing costs Total expected increase in expenses S Variable costs Direct materials Direct labour Variable overhead Fixed overhead. 0.13 0.06 0.12 0.25 Expected increase (decrease) in operating income Decision 0.56 Total cost Requirement 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star-Cardz must spend $5,100 to develop this hologram, which Incremental analysis to determine
Requirement 2. Now assume that the Hall of Fame wants special hologram hockey cards. Star-Cardz must spend $5,100 to develop this hologram, which will be useless after the special order is completed. Prepare an incremental analysis to determine whether Star - Cardz should accept the special order under these circumstances. (Enter a zero in an input box if there is no expected change in the expense. Use parentheses or a minus sign for an expected decrease in operating income.) Star-Cardz Incremental Analysis of Special Sales Order Expected increase in revenues Expected increase in expenses: Variable manufacturing cost Fixed manufacturing costs Total expected increase in expenses Expected increase (decrease) in operating income Decision: Enter any number in the edit fields and then continue to the next question

Answers

The following table contains required computations in the specified format:

1 $ 20,880 Star-Cardsz Incremental analysis of Special Sales Order Expected increase in revenues Expected increase in expense

.

Similar Solved Questions

1 answer
Cam ABC is supported by a post at B. The coefficient of static friction between the...
cam ABC is supported by a post at B. The coefficient of static friction between the post and the Beall at is g = 0.28. The coefficient of static friction between the post and the ground at Dis Ho = 0.21. The coefficient of kinetic friction between the post and the beam at Bis Ug = 0.20. The coeffici...
1 answer
Consider the following hypotheses: H0: μ = 19 HA: μ ≠ 19 The population is normally...
Consider the following hypotheses: H0: μ = 19 HA: μ ≠ 19 The population is normally distributed. A sample produces the following observations: (You may find it useful to reference the appropriate table: z table or t table) 20 23 17 21 21 24 23 Click here for the Excel Da...
1 answer
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its...
The strand below is a piece of DNA coding strand 5' - ACTCCGGGTGAGGTATCAAT - 3' Its reading frame is set and it can be seen in the middle of the gene sequence. Write out its mRNA strand sequence....
1 answer
STEEL 2. Figure (b) shows a bolt under tension (M20x2.5). The property class of the bolt...
STEEL 2. Figure (b) shows a bolt under tension (M20x2.5). The property class of the bolt is ISO 8.8. The design factor is na=3.0 for the bolt. Answer the following questions. (a) Determine the whole bolt length (L) of the bolt (consider 3 threads after the nut). What are the thread (Lt) and the shan...
1 answer
Calculate the (a) current flowing in the circuit below and (b) voltage drop across the resistor...
Calculate the (a) current flowing in the circuit below and (b) voltage drop across the resistor Ron the right. The temperature is 600K. The battery voltage is 5 V. The resistance R-1 Giga Ohm. The equation for current through the diode is 1" 18 9 (exp/Vd/(2*VT)) - 1) Amperes. Vd is the voltage d...
1 answer
(1) Evaluate the integral. (Hint: Substitution Rule) (2.1 + 3)(2x + 6x + 1)*der
(1) Evaluate the integral. (Hint: Substitution Rule) (2.1 + 3)(2x + 6x + 1)*der...
1 answer
Find the present value of $11,000 if the interest paid is at a rate of 10%...
Find the present value of $11,000 if the interest paid is at a rate of 10% compounded continuously for 2 years. The present value is $ (Do not round until the final answer. Then round to the nearest cent as needed.)...
1 answer
A sensor about the pivot axis O measures a resulting moment of 41 N.m, what is...
A sensor about the pivot axis O measures a resulting moment of 41 N.m, what is the magnitude of F? se ա 6'0...
1 answer
An example of a nonspontaneous process with negative ∆H0 and negative ∆S0 would be a. H2O(g)...
An example of a nonspontaneous process with negative ∆H0 and negative ∆S0 would be a. H2O(g) -> H2O(l) at 1050C    b. H2O(g) -> H2O(l) at 950C d. H2O(l) -> H2O(g) at 1050C e. H2O(l) -> H2O(g) at 950C...
1 answer
Sports sales for Hype Sports Inc. is a retailer of clothing and sports equipment. The following...
Sports sales for Hype Sports Inc. is a retailer of clothing and sports equipment. The following is Hype Spor by quarter for the upcoming year. Hype Sports Inc. Forecasted Sales For the Year Ending December 31, 2019 01 02 03 $115,000 $300,000 $350,000 04 $250,000 000 Periode $1,01 Sales 51,015.000 ly...
1 answer
How do you multiply #(5x+9)(2x-3)#?
How do you multiply #(5x+9)(2x-3)#?...
1 answer
AM radio signals broadcast electromagnetic radiation at frequencies between 530 kHz and 1.10 MHz. (a) What is the shorte...
AM radio signals broadcast electromagnetic radiation at frequencies between 530 kHz and 1.10 MHz. (a) What is the shortest wavelength of an AM radio signal?...
1 answer
Organic chemistry help *) Please mirror the molecule A along the mirror plane given. Homework 1 on chirality b.) Loo...
organic chemistry help *) Please mirror the molecule A along the mirror plane given. Homework 1 on chirality b.) Look at the two compounds, A and B below. Are they the same molecule or are they image and mirror-image?...
1 answer
Emma's On-the-Go, a large convenience store that makes a good deal of money from magazine sales,...
Emma's On-the-Go, a large convenience store that makes a good deal of money from magazine sales, has three possible locations in the store for its magazine rack: in the front of the store (to attract "impulse buying" by all customers), on the left-hand side of the store (to attract teena...
1 answer
How many liters of NH3 (measured at stp) can be produced by reacting 8.45 Liters (stp)...
How many liters of NH3 (measured at stp) can be produced by reacting 8.45 Liters (stp) N2 with 2.98 x 10^23 molecules H2? Write the balanced equation....
1 answer
Please answer the following question. ACCT-212 Assignment #2 Answer True or False for the following: Actual...
please answer the following question. ACCT-212 Assignment #2 Answer True or False for the following: Actual manufacturing costs are recorded as a credit under the manufacturing overhead T-account. The journal entry to record issuance of direct materials includes a debit to manufacturing overhead....
1 answer
The debits to Work in Process—Roasting Department for Morning Brew Coffee Company for August, together with information...
The debits to Work in Process—Roasting Department for Morning Brew Coffee Company for August, together with information concerning production, are as follows: Work in process, August 1, 500 pounds, 10% completed $1,610* *Direct materials (500 X $3.1) $1,550 Conversion (500 X 10% X...