1 answer

Part G. Geologic Time Questions (left diagram) 23. The individual layer-units (periods) of geologic time in...

Question:

Part G. Geologic Time Questions (left diagram) 23. The individual layer-units (periods) of geologic time in the column are ba
205.JPG Part Ane
Part G. Geologic Time Questions (left diagram) 23. The individual layer-units (periods) of geologic time in the column are based on Part G. Answers (see right diagram) A. similar rock types B. similar layer thicknesses C. similar fossil assemblages D. similar mode of origin E. similar world-wide occurrence
205.JPG Part Ane

Answers

Part-G. A. Similar rock types.

Eras (based on the appearance and extinction of fossils) are divided into Periods. A unit of geologic time in which a a single type of rock system is formed is Period. Cambrian is a Period of Paleozoic Era.  

.

Similar Solved Questions

1 answer
The compound shown below is the product of a Claisen condensation. Draw structural formulas for the...
The compound shown below is the product of a Claisen condensation. Draw structural formulas for the reactants: ester and enolate ion Насо, ОСНЗ Assume all esters to be ethyl esters Do not include counter-ions, e.g., Na", I, in your answer Draw the ...
1 answer
5. (a) Find the rate of conversion of chemical energy to electrical energy in the battery...
5. (a) Find the rate of conversion of chemical energy to electrical energy in the battery power of emf). 1.0 12.0 v ww 5.02 (b) Find the rate of dissipation of electrical energy in the battery. (c) Find the rate of dissipation of electrical energy in the external resistor....
1 answer
9rt, lertertw worla .woled (r) noitsupe Vd nevie noitelen tuqtuo-tugni er廿10ㅋ ·ρ eldste O8la ai metave...
9rt, lertertw worla .woled (r) noitsupe Vd nevie noitelen tuqtuo-tugni er廿10ㅋ ·ρ eldste O8la ai metave enibnogeemoo (n)x(1-n) = (n)...
1 answer
What is the decimal equivalent of #25/200#?
What is the decimal equivalent of #25/200#?...
1 answer
The clinical microsystem includes which of the following? a. National service frameworks b. Whole patient journey...
The clinical microsystem includes which of the following? a. National service frameworks b. Whole patient journey c. Inter microsystem work d. Synthesis of individual, team, and patient...
1 answer
4. a) Solve the equation log2 (x - 5) - log: ( x - 2) +1...
4. a) Solve the equation log2 (x - 5) - log: ( x - 2) +1 algebraically. b) Verify your answers are reasonable by graphing both y = log2 (x - 5) and y = log: (x-2) +| on the same set of axes....
1 answer
II. Number of Signals 2. Predict the number of unique protons that would generate peaks in an NMR spectrum. Look at...
II. Number of Signals 2. Predict the number of unique protons that would generate peaks in an NMR spectrum. Look at Figure 13.6 and example problem 13.2 for guidance. Then for each of these unique proton signals, predict the ppm range where you would find it and the integration value or signal area....
1 answer
Koreatown Merchandising Company Financial Data Dollar Percen 2015 $ 450,000 300,000 80,000 30,000 $ 40,000 Change...
Koreatown Merchandising Company Financial Data Dollar Percen 2015 $ 450,000 300,000 80,000 30,000 $ 40,000 Change Change 50,000 |-10% 380,000-420,000 |-4,5% 60,000 sa 0,000 133% 5000 | 20% 2014 $ 500,000 Sales Cost of Goods Sold Operating Expenses Income Taxes 25,000 Net Income sooo 5% Comparative A...
1 answer
2.Heights of the Highest Waterfalls The heights in feet) of the 20 highest waterfalls in the...
2.Heights of the Highest Waterfalls The heights in feet) of the 20 highest waterfalls in the world are shown here. (Note: The height of Niagara Falls is 182 feet!) below. Based on these data, what do you think of the claim that the average expenditure per pupil in the United States exceeds $10,000? ...
1 answer
QUESTION 7 Explain with examples the consideration of human resources in the international business.
QUESTION 7 Explain with examples the consideration of human resources in the international business....
1 answer
Factory Overhead Cost Budget Sweet Tooth Candy Company budgeted the following costs for anticipated production for...
Factory Overhead Cost Budget Sweet Tooth Candy Company budgeted the following costs for anticipated production for August: Advertising expenses $244,590 Manufacturing supplies 13,410 Power and light 39,980 Sales commissions 264,250 Factory insurance 23,280 Production supervisor wages 11...
1 answer
NASCAR fans love race day when they get a chance to cheer on their favorite team! If a driver was able to travel 600 miles in 3 hours, what was his average speed?
NASCAR fans love race day when they get a chance to cheer on their favorite team! If a driver was able to travel 600 miles in 3 hours, what was his average speed?...
1 answer
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is...
The sequence of part of an mRNA transcript is 5' – AUGAGCAACAGCAAGAGUGCGGCACUGUCCACAGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG -3' What is the sequence of the DNA template strand? 5'- || -3' BI U x2 x2...
1 answer
Please post the values in correct order with the descriptions Profit Center Responsibility Reporting XSport Sporting...
please post the values in correct order with the descriptions Profit Center Responsibility Reporting XSport Sporting Goods Co. operates two divisions-the Winter Sports Division and the Summer Sports Division. The following income and expense accounts were provided from the trial balance as of Decemb...
1 answer
The area of a square is 72m^2. How long is the diagonal?
The area of a square is 72m^2. How long is the diagonal?...
2 answers
What is the equivalent capacitance of the capacitor network shown in Fig. 24-7? (All the...
What is the equivalent capacitance of the capacitor network shown in Fig. 24-7? (All the capacitors have a capacitance C = 5 μF. The voltage of the battery isV = 6V.)Answer3 μF5 μF10 μF20 μF1 μF...
1 answer
3. Which indicator has a fast and slow version where the slow version is a doubly...
3. Which indicator has a fast and slow version where the slow version is a doubly smoothed moving average? a. moving average convergence divergence b. stochastic oscillator c. simple moving average d. McClellan Summation Index e. none of the above...
2 answers
Are there any rainforests in in North America?
Are there any rainforests in in North America?...