Answers
The answer has been presented in the supporting sheet. For detailed answer refer to the supporting sheet.
Answer Firstly we have to calculate the interest rate of loan monthly = i% Amount of loan/ installment amount = Present value annuity (i%,48) (22000-9500)/308.1 = ((1-(1+i%)^-48)/i%) 40.57124 = ((1-(1+i%)^-48)/i%) From present value table this annuity is for.70833 % motnly Yearly interest rate -8.5% (.70833%*12) Amount of loan paid off at the end of 30 months = monthly installment * ((1-(1+(8.5%/12)) ^-18)/(8.5%/12)) = 308.1* ((1-(1+(8.5%/12))^-18)/(8.5%/12)) = 308.1*16.84389 = $ 5189.6 - Thus amount of loan to be payoff = $ 5189.6 Unearned interest = (monthly installment *18) - amount pay off = = (308.1*18) - 5189.6 = $ 356.2 Thus the amount of unearned interest = $ 356.2
.
Similar Solved Questions
1 answer
Question 3 Not yet answered When a person stands on a scale in an elevator at...
Question 3 Not yet answered When a person stands on a scale in an elevator at rest, the scale reads 800 newtons. When the elevator is allowed to fall freely with acceleration of gravity, then the scale will read Marked out of 200 P Flag question Select one: O a 1600 newtons Ob 800 newtons O C. None ...
1 answer
A hypothesis test yields a test statistic of z = 1.18. Compute the P-value if this...
A hypothesis test yields a test statistic of z = 1.18. Compute the P-value if this is a one-tailed test and if it is a two-tailed test. O one-tailed P-value is 0.881; and two-tailed P-value is 0.4405 O one-tailed P-value is 0.119; and two-tailed P-value is 0.238 one-tailed P-value is 0.119; and two-...
1 answer
Gauss's law is usually written phi _E = contourintegral E vector middot dA vector = q_encl/epsilon...
Gauss's law is usually written phi _E = contourintegral E vector middot dA vector = q_encl/epsilon _0 where epsilon _0 = 8.85 times 10^-12 C^2 /(N middot m^2) is the permittivity of vacuum. Correct In the integral for Gauss's law, the vector dA^vector represents an infinitesimal surfa magnit...
1 answer
132 1/PRINCIPLES OF HEALTH CARE ETHICS CASES FOR ANALYSIS 1. Mary is in need of a...
132 1/PRINCIPLES OF HEALTH CARE ETHICS CASES FOR ANALYSIS 1. Mary is in need of a kidney transplant, and her parents and siblings have been tested for compatibility. Her father is afraid of operations and knows that kidney trouble runs in the family. Before the test, Mary's father tells the doct...
1 answer
Score: 0 of 1 pt Save 4 of 6 (4 complete) 6.3.17 Hw Score: 41.67%, 2.5...
Score: 0 of 1 pt Save 4 of 6 (4 complete) 6.3.17 Hw Score: 41.67%, 2.5 of 6 pt Question Heip A multi-state lottery advertises the prizes and probabilities of winning shown in the accompanying table for a single S1 ticket The ?ad t i an ble but t has an average of $3 million. Note that the same prize...
1 answer
Lindell Manufacturing embarked on an ambitious quality program that is centered on continual improvement. This improvement...
Lindell Manufacturing embarked on an ambitious quality program that is centered on continual improvement. This improvement is operationalized by declining quality costs from year to year. Lindell rewards plant managers, production supervisors, and workers with bonuses ranging from $1,000 to $10,000 ...
1 answer
Exercise (2): Implement the digital circuit in Fig. 2 using VHDL. D Q D, 2 9 CLKJ Figure 2
please explain that, compile it and give me a solution as text Exercise (2): Implement the digital circuit in Fig. 2 using VHDL. D Q D, 2 9 CLKJ Figure 2 Exercise (2): Implement the digital circuit in Fig. 2 using VHDL. D Q D, 2 9 CLKJ Figure 2...
1 answer
The Hubble Space Telescope orbits about 600 km above the Earth. It's 2.4 meters across. If...
The Hubble Space Telescope orbits about 600 km above the Earth. It's 2.4 meters across. If we were to aim the HST down instead of up, how big would be the smallest details we can make out on the surface using visible light?...
3 answers
A farmer grows 196 pounds of potatoes
A farmer grows 196 pounds of potatoes. He sells them to a grocer who divides them into 5 pound and 20 pound bags. if the grocer uses the same number of 5 pounds and 20 pound bags, how many bags of each did he use?...
1 answer
TUTI) 8. and h(x) = 3x - 2, a) If g(x) = 2x + 10 3...
TUTI) 8. and h(x) = 3x - 2, a) If g(x) = 2x + 10 3 Find: - (3 marks) and express in its simplest form g[h(x)] = find f'(x) b) If f(x) = = 2x - 1 3x + 4 (4 marks)...
1 answer
1. The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the...
1. The mRNA reads UGUGAUGACGAACGAGGGACUGA What does the sequence of the tRNAs read? What is the sequence of the amino acids? 3. (6 pts.) Make a diagram of the prokaryotic initiation of transcription - include the +1 start site, the -10 and the -35 sites and RNA polymerase plus sigma factor....
1 answer
How do you simplify #(10x^3-25x^2+4x-10)/(-4-10x^2)#?
How do you simplify #(10x^3-25x^2+4x-10)/(-4-10x^2)#?...
1 answer
Preble Company manufactures one product. Its variable manufacturing overhead is applied to production based on direct...
Preble Company manufactures one product. Its variable manufacturing overhead is applied to production based on direct labour-hours, and its standard costs per unit are as follows: Direct materials: 4 kg at $9.00 per kg $ 36.00 Direct labour: 3 hours at $12 per hour 36.00 Variable overhead: 3 hours a...
1 answer
A 15.4 cm long tendon is found to stretch 2.63 mm when a force of 15...
A 15.4 cm long tendon is found to stretch 2.63 mm when a force of 15 0 N is applied to it. If the tendon is round and as an average diameter of 6.94 mm, calculate the Young's modulus of this tendon Number IUnits...
1 answer
Mark which account categories apply to the transactions. Assets Liabilities Equity Revenue Expense 1. Purchased computer...
Mark which account categories apply to the transactions. Assets Liabilities Equity Revenue Expense 1. Purchased computer using CC 2. Bought lunch for cash 3. Earned a paycheck 4. Made payment on CC 5. Depreciated computer For each of the above transactions indicate which account categories would be ...
1 answer
Give the correct organic products, in any order, for the following ozonolysis reaction: 1. O,, CH,Cl, -78'C + 2. Zn,...
Give the correct organic products, in any order, for the following ozonolysis reaction: 1. O,, CH,Cl, -78'C + 2. Zn, HOAc...
1 answer
3. What factors should be taken into consideration when selecting a discounting factor to calculate the...
3. What factors should be taken into consideration when selecting a discounting factor to calculate the net present value of a capital purchase?...