1 answer

INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

Question:

INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Su
3) What 3 to 5 DNA sequence would correspond to a s AUG.3-start codon? U 6–3 RNA 5-A DNA 3- 4) Read the DNA sequence given
6) Identify the start codon that is immediately downstream (towards the 5 end, after the promoter) of the promoter. Indicate
INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'. For each DNA sequence given below, write the mRNA sequence that would be coded from it. Make sure you indicate the direction of each mRNA strand (i.e. 3' and 5'ends). Use the Universal triplet code to determine the sequence of amino acids that would be generated for each of the mRNA sequences that you generated in question 2. Remember that the reading of mRNA goes in the 5'-3' direction (see lab notes for examples). . To make the mRNA, read from LEFT TO RIGHT- To make the amino acid, read triplets from Left to Right DNA 3-TACCTACTTTGCCCGATCCAT-5' mRNA 5... amino acid b. Read letter by letter from RIGHT TO LEFT To make the amino acid, read triplets from Left to Right DNA 5'-TACCTACTTTGCCCGATCCAT-3 mRNA 5. amino acid c. Are the amino acid sequences in a and b the same? YES_
3) What 3 to 5 DNA sequence would correspond to a s AUG.3-start codon? U 6–3' RNA 5-A DNA 3'- 4) Read the DNA sequence given below in the 3 to 5' direction and circle all of the potential start codons (i.e. every time you see the DNA version of a start codon- as in qu 3). How many potential start codons did you find? Line YOUR DNA SEQUENCE (read from left to right) 3- TTCCGTAACTTCGGCGCATCTAGCTTGAGCTCCAATCAGG ACTACTTATAAA AATCTTCTCGAGAGAGCTTTACTCCTACTC TCTTAGTCGATTCCATCGGACCTACGATTGACAAGCGCGGTC TACTATCTACTTATTTATTTACGAGCGTTGATTCTACCTACTG ACGACTAGGGCATICTATAGGATTAACTCCITATTTTAACTA ACTTCCTGGGAAGGCGCCTTTATC TGATCCGTAATCCGTCCG AAGGCTCTGATCUGATTACTGGGTCACTGGAAAGTGACCGCT GTCTATTACTGTATTTCATCTGATTGACTATTITATAGTCG-5' 5) Now find and circle the promoter region 3'-TATAAAA-S' in your sequence above,
6) Identify the start codon that is immediately downstream (towards the 5' end, after the promoter) of the promoter. Indicate the codons that follow the start, and continue until you reach a stop codon. 7) Copy the entire coding sequence that is found in question 4 (from, and including the start codon to the stop codon). Hint: there are 19 codons, each with 3 base pairs, and the coding region is between lines 2 and 4. 5 6 8)Now write down the mRNA sequence that would be generated from the DNA sequence from question 7. Hint: there are 19 codons, each with 3 base pairs. 9) Finally write out the sequence of amino acids that the mRNA sequence in question 8 would code for. Hint: there are 18 amino acids (including the start/methionine- remember that STOP codon does not code for an amino acid). Use the Universal Triplet code from the Gene Expression tutorial document, ..... ... .. 10 11 12 13 14 15 16

Answers

1) complementary dna strand:

1) DNA (Complementary strand is) 3-ATTGCYTACTTGCAT-5. 5. TAAC, AAT, AA (GTA - 3 2)DNA al 3-TACCTACTIT GCC CGATCCAT-S mRNAS

3)the DNA sequence that is corrosponding to AUG start codon is:

3 corresponds to The DNA sequence that AUG start codon is a RNA 5-AUG- 3 DNA 3 TAC

.

Similar Solved Questions

1 answer
Comment on the given data and answer question given in data answer the questions given under...
comment on the given data and answer question given in data answer the questions given under every table! use the table data the answer it! 2. ENZYME REACTION OVER TIME Tube Reaction time Abs. 30 $ 6os 10 S ao s 50 N/A 011 0.202 0.355 0.489 0.690 Comment on the effect of reaction time on the r...
1 answer
11. Predict the product of the following reaction. 1. NaOCHg/CH3OH 2. Zn/Hg. HCI i a. I...
11. Predict the product of the following reaction. 1. NaOCHg/CH3OH 2. Zn/Hg. HCI i a. I b. II c. III d. IV e. V 1 Dredit thandu at f .11...
1 answer
Procie synthesis without using a gilman reagent = CH3 CH3 CH3 CH3 CH3
procie synthesis without using a gilman reagent = CH3 CH3 CH3 CH3 CH3...
1 answer
What is the coefficient of aluminum when the following equation is balanced with small, whole-number coefficients?...
What is the coefficient of aluminum when the following equation is balanced with small, whole-number coefficients? _ Al(s)+ _ HC (9) — _ AICI (s) + _ H (9)...
1 answer
Q13 c++ if answering please do not write code in paragrapth form. 13. Drink Machine Simulator...
q13 c++ if answering please do not write code in paragrapth form. 13. Drink Machine Simulator Write a program that simulates a soft drink machine. The program should use a structure that stores the following data: Drink Name Drink Cost Number of Drinks in Machine The program should creat...
1 answer
Question 3 1 pts maintenance, supervision are direct labor costs O True O False DQuestion 4...
Question 3 1 pts maintenance, supervision are direct labor costs O True O False DQuestion 4 2 pts materials used on a job are written on which of the following O bill of materials material requisition form production order...
1 answer
CH 22 Question: 1. Mr. Walden, a high school psychologist, was recently asked to consult with...
CH 22 Question: 1. Mr. Walden, a high school psychologist, was recently asked to consult with the teachers and parents of Robert, a student who is having academic and social problems. What types of tools would assist Mr. Walden in evaluating this student before the consultation? What medical terms w...
1 answer
Show some supporting calculations. Use the original definition of sums of squares (Formula 10A). Note that:...
Show some supporting calculations. Use the original definition of sums of squares (Formula 10A). Note that: Σ014, MSFs Σοϊ2 Follow the 4-step hypothesis test outline. Give the reject region or the P.value. In R, issue the commands o o .qf(1-01,2,27) to get the critical value...
1 answer
1. You are helping a victim who has cut his leg with a chainsaw. It is...
1. You are helping a victim who has cut his leg with a chainsaw. It is spurting blood with each heartbeat. What should you do first? a. Apply a pressure bandage. b. Apply direct pressure to the wound and consider applying a pressure bandage. c. Lower the wound below heart level and wrap a pressure b...
1 answer
The principal investigator (PI) for the laboratory you are doing research in has tasked with you...
The principal investigator (PI) for the laboratory you are doing research in has tasked with you with preparing 250 mL of an aqueous zinc sulfate (ZnSO4) solution with a concentration of approximately 50. mM- it is not critical for the solution to be exactly 50 mM, it is just critical to know what i...
1 answer
I need a detailed solution please, thanks! 4. Find the initial and final values of the...
I need a detailed solution please, thanks! 4. Find the initial and final values of the function ft) whose Laplace Transform is given by: 2s +1 F(s) = s2+ s + 1 5. Find the inverse Laplace Transform of (a) F(s)= 1 s(s2+23+2) (b) F(s)= s(s2+a2)...
1 answer
For silicon at room temperature verify that Nc=1.8x1019 cm-3. Show both the numerical and units compution....
For silicon at room temperature verify that Nc=1.8x1019 cm-3. Show both the numerical and units compution. For silicon at room temperature verify that ni~1x1010 cm-3....
1 answer
There are two spheres with uniformly distributed charges -q and +q through their volumes. The spheres...
There are two spheres with uniformly distributed charges -q and +q through their volumes. The spheres have radii R, and 2R respectively. Point P lies on the surface of the larger sphere on a line connecting the centers of the spheres. Find the electric field at point P if -q=+q= 30 fC, and R=2cm....
1 answer
Suppose the current exchange rate for the Russian ruble is RUB 34.53. The expected exchange rate...
Suppose the current exchange rate for the Russian ruble is RUB 34.53. The expected exchange rate in three years is RUB 37.75. What is the difference in the annual inflation rates for the United States and Russia over this period? (A negative answer should be indicated by a minus sign. Do not round i...
1 answer
A. Ivanhoe Corporation reported the following selected information for the two years ended December 31: 2017...
a. Ivanhoe Corporation reported the following selected information for the two years ended December 31: 2017 2018 Total assets $560,000 $630,000 Total liabilities 390,000 420,000 Calculate total shareholders’ equity on December 31, 2017, and 2018. 2017 2018 Total s...