1 answer

I hope the solution is clear photo and fast Consider a Carnot refrigeration cycle executed in...

Question:

Consider a Carnot refrigeration cycle executed in a closed system in the saturated liquid-vapor mixture region using 0.909 kg

I hope the solution is clear photo and fast
Consider a Carnot refrigeration cycle executed in a closed system in the saturated liquid-vapor mixture region using 0.909 kg of refrigerant-12 as the working fluid. It is known that the maximum absolute temperature in the cycle is 1.25 times the minimum absolute temperature, and the net work input to the cycle is 25 kl. If the refrigerant changes from saturated liquid to saturated vapor during the heat rejection process, determine the minimum pressure in the cycle, in kPa.

Answers

Son: The data given for carnot refrigeration cycle are mzo Tmin - The cop of & COP = car onot TL = TH-Ti nax = 1.25. Work inp- compressor work for cannot refrigeration cycle as, d a n W.R- P2 : V2-PIVI - MR C T2-T - o. gog, 0.0688. (T2-TDX103 1.14 -i. Properties of R-12 at Tmin=223.9k v=0.3831 m3/kg, but mrt 2, N=0.3482 m),, PV = m РТ.</p><p>Р. = oqoyxo. 06 88 х 10 х 223 Ф• 3482 JP, – Pm) = 4o. 21ч ЕР° |

.

Similar Solved Questions

1 answer
Please provide the product of the acid base reaction.
Please provide the product of the acid base reaction....
1 answer
PRELAB ASSIGNMENT 1. Draw an electron-dot structure for CF. Then, complete the following table, based on...
PRELAB ASSIGNMENT 1. Draw an electron-dot structure for CF. Then, complete the following table, based on a VSEPR prediction. roup BondingTLone l Bond Angle-Shape ment Regions Pairs Molecular Molecule Electron Groups Arrange CF Draw the condensed and expanded structural formula for the molecule with ...
1 answer
Boehm Incorporated is expected to pay a $1.80 per share dividend at the end of this...
Boehm Incorporated is expected to pay a $1.80 per share dividend at the end of this year (i.e., D1 = $1.80). The dividend is expected to grow at a constant rate of 10% a year. The required rate of return on the stock, rs, is 16%. What is the estimated value per share of Boehm's stock? Round your...
1 answer
2.22 Recently, consumer electronics sales in China have incieased rearly 10% The Chinese market is increasingly...
2.22 Recently, consumer electronics sales in China have incieased rearly 10% The Chinese market is increasingly competitive Japanese, U.S., and European firms are investing in production facilities in China to capture the benefis of low cost production there Pantagruelis a US based firm that has spe...
1 answer
For a charged particle (with charge e) in an electromagnetic field the Hamiltonian can be written...
For a charged particle (with charge e) in an electromagnetic field the Hamiltonian can be written as: 1 e H (inő A) +eº (2) 2m where A is the vector potential and o is the scalar potential of the field. a) Find the form of the operator for the velocity, v, of a charged particle in an elect...
1 answer
11. Consider the circuit shown in Figure Q16.11. How is the cur- rent through resistor 1...
11. Consider the circuit shown in Figure Q16.11. How is the cur- rent through resistor 1 related to the currents through the other two resistors? (a) I2 (b) I (c) 2 I W W (e) I -I,...
1 answer
Only question 2 (gross profit) P7-3 Comparing and Contrasting the Effects of Inventory Costing Methods on...
Only question 2 (gross profit) P7-3 Comparing and Contrasting the Effects of Inventory Costing Methods on Financial Statement Elements LO7-2, 7-3 Neverstop Corporation sells item A as part of its product line. Information about the beginning inventory purchases, and sales of item A are given in the ...
1 answer
When working with vendors, you are giving up a certain amount of control and trusting them to secure your data appropriately. This can be an issue without the proper knowledge of their procedures and...
When working with vendors, you are giving up a certain amount of control and trusting them to secure your data appropriately. This can be an issue without the proper knowledge of their procedures and best practices and a good SLA (service level agreement). Design the basics of what your company woul...
1 answer
Ch. 2.1.2.6 Problem 2.73 K18 of Constants An elite human sprinter reaches his top speed of...
Ch. 2.1.2.6 Problem 2.73 K18 of Constants An elite human sprinter reaches his top speed of 11.8 m/s at a time of 7.07 s after the starting gun. In the first 1.43 s, however, he reaches a speed of 8.00 m/s, with a nearly constant acceleration. Part A Calculate his maximum acceleration during the star...
1 answer
Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a...
Consider the problem of searching for genes in DNA sequences. ADNA sequence is represented by a text on the alphabet A, C, G, T, and the gene or gene segment is the pattern. Pattern: TCCTATTCTT Text: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT a. Construct the good suffix table of the pattern for the Boy...
1 answer
Problem 1 This L-beam is in Equilibrium. Determine the reactions at the fixed-end support a) FBD...
Problem 1 This L-beam is in Equilibrium. Determine the reactions at the fixed-end support a) FBD b) Solve for the reactions (YOU SHOULD HAVE 3 and only 3!) |2ft ----2ft - 200 lb 160580 300 Sin 30° 2 ft 150 165 150 lb 1 2 ft 300 lb 3097 2 ft 10 50'...
1 answer
A student is given an unknown aqueous solution that contains either the divalent ion or trivalent...
A student is given an unknown aqueous solution that contains either the divalent ion or trivalent ion of a certain metal (that is, the solution either contains metal(II) ions or metal(III) ions of the same metal). The student was also given a dilute solution of potassium permanganate which had a viv...