1 answer

4. Which of the following energy diagrams corresponds to a one-step exothermic reaction with a high...

Question:

4. Which of the following energy diagrams corresponds to a one-step exothermic reaction with a high energy of activation? nat
4. Which of the following energy diagrams corresponds to a one-step exothermic reaction with a high energy of activation? nat A. A B.B C.C D.D E. E

Answers

Energy diagram that corresponds to one step exothermic reaction with highest activation energy :

Exothermic reaction is exergonic process where energy is released. The initial line of the energy diagram indicates reactants and heap is the process of converting the reactants to products i.e. intermediate or transition step. The last line indicates products.

For a one step exothermic reaction there will be only one heap whereas two step exothermic reaction there will be two heaps.

For a exothermic reaction, energy is released. Hence enthalpy of reactants is greater than the enthalpy of products.

The excess energy is released. Hence reactants energy line is higher in position than the products.

Whereas in endothermic reaction, energy is absorbed. Hence enthalpy of reactants is lesser than the enthalpy of products. The excess energy is absorbed. Hence reactants energy line is lower in position than the products.

Activation energy is the difference of energy of reactant and transition state.

From the above graphs :

The exothermic graphs are A, B and E.

But E is two step exothermic reaction.

Among A and B option the one with highest activation energy is Graph B because the energy difference between the reactants (initial line) and transition state (heap - highest point) is higher than the Graph A.

.

Similar Solved Questions

1 answer
Propose buffer components to hold a pH = 10.8 Let the base have a concentration of...
Propose buffer components to hold a pH = 10.8 Let the base have a concentration of 0.35 M. Identity Concentration Acid ? ? Base ? 0.35 M Ksp values: CaCO3 CaF2 Ca(OH)2 Ca3(PO4)2 Fe(OH)2 Fe(OH)3 MgCO3 8.7 x 10-9 4.0 x 10-11 8.0 x 10-6 1.2 x 10-26 1.6 x 10-14 1.1 x 10-36 4.0 x 10-5 Mg(OH)2 A...
1 answer
Fields on the Page Estimate the maximum magnitudes of the electric and magnetic fields of the...
Fields on the Page Estimate the maximum magnitudes of the electric and magnetic fields of the light that is incident on a page because of the visible light coming from your desk lamp. Treat the lightbulb as a point source of electromagnetic radiation that is 6% efficient at transforming energy comin...
1 answer
A computer system uses passwords constructed from the 26 letters (a-z) or 10 integers (0-9). Suppose...
A computer system uses passwords constructed from the 26 letters (a-z) or 10 integers (0-9). Suppose there are 10,000 users on the system with unique passwords. A hacker randomly selects (with replacement) passwords from the potential set. Round your answers to the nearest integer (a) There are 8,90...
1 answer
You are considering an investment in Justus Corporation's stock, which is expected to pay a dividend...
You are considering an investment in Justus Corporation's stock, which is expected to pay a dividend of $1.75 a share at the end of the year (D1 = $1.75) and has a beta of 0.9. The risk-free rate is 4.6%, and the market risk premium is 4.0%. Justus currently sells for $23.00 a share, and its div...
1 answer
Describe the situation Dr.Gayle found at care. why was change needed CARE, one of the world's...
Describe the situation Dr.Gayle found at care. why was change needed CARE, one of the world's leading nongovernmental organizations, was created to provid DR. GAYLE BRINGS COLLABORATION TO CARE ar II. When Dr. Helene Gayle became CEO in 2006-after working at both the ter for Disease Con...
1 answer
Please help this is the second time i post this and the first time was wrong...
please help this is the second time i post this and the first time was wrong so please help me and show all the steps [10 pts.) 9. Show how to use IBP to get the the power reduction rule... ſ sin sin"(x)dx sin"-'(x) cos(x) n-1 and then use it to help find the volume m="S sin(...
1 answer
) In your opinion, discuss the importance of Correlation and Regression as a tools for analysis...
) In your opinion, discuss the importance of Correlation and Regression as a tools for analysis purposes...
1 answer
16. What is the limiting reactant when 1.50 g of lithium and 1.50 g of nitrogen...
16. What is the limiting reactant when 1.50 g of lithium and 1.50 g of nitrogen combine to form lithium nitride, a component of advanced batteries, according to the following unbalanced equation? Li+N, — LizN 17. What is the concentration of NaCl in a solution if titration of 15.00 mL of the s...
1 answer
EM wavelength in water 1. At frequency w = 10 GHz, liquid water has a permittivity...
EM wavelength in water 1. At frequency w = 10 GHz, liquid water has a permittivity e = 1 i€2, With ei 80eo, 15€0, and a permeability u= Ho E2 (a) Starting from the Maxwell equations, show that the wave equation for EM waves in water, is given by VE(r, t) eHo2Er, t) (b) Show that the wave ...
1 answer
Question 10 (1 point) CASE STUDY Airbnb is an accommodation-sharing platform that relies heavily on guest...
Question 10 (1 point) CASE STUDY Airbnb is an accommodation-sharing platform that relies heavily on guest ratings The figure below shows the number of accommodations in each rank category where 5.0 is excellent and 1.0 is poor. 4500 4000 Number of 5.0 4.5 4.0 3.5 3.0 25 20 15 10 Rating If you took r...
1 answer
Please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...
please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT...
1 answer
7. The market for rental housing in Berkeley is subject to rent-control. Before rent control, the...
7. The market for rental housing in Berkeley is subject to rent-control. Before rent control, the compet itive equilibrium was at Pc and Q. Rent control limits the price a landlord can charge to P. The short-run supply curve is upwards sloping, and long-run supply is horizontal. (a) Is this a consta...
1 answer
Question 11 (1 point) 11. Which of the following is a request that can be answered...
Question 11 (1 point) 11. Which of the following is a request that can be answered using an OUTER JOIN? a. Show me customers and employees who have the same name. b. Find the bowlers who live in the same ZIP code c. What products have never been ordered? d. Show me the students and their teachers wh...
1 answer
Please i need help this is the second time i post this please help and show...
please i need help this is the second time i post this please help and show all the steps and make sure it's correct her weight grows a arate that is rectly proportional to the concen (a) A calf weighs 55 pounds at b. As we us over the next years, hermated mamum we of 1200 pounds and her curr...
1 answer
Create a one time pad encryption using chat-server so that two clients are communicating through a...
Create a one time pad encryption using chat-server so that two clients are communicating through a server sending private encrypted messages (button) and each have the ability to decrypt (button) the message. JAVA PLEASE...
1 answer
Identify at least 2 major diseases affecting the Hypothalamic-Pituitary System and what would happen without treatment?
Identify at least 2 major diseases affecting the Hypothalamic-Pituitary System and what would happen without treatment?...
1 answer
O. Reactions. Please complete the following reaction schemes with the appropriate alkyl halide, reagent os NaOH...
o. Reactions. Please complete the following reaction schemes with the appropriate alkyl halide, reagent os NaOH Br NaCN SN27 elimination product(s) substitution product(s) SN1 кон elimination product(s) circle the major product substitution productis) SN1 t-butoxide NaOMe SN2? elim...