Write an essay about choosing Pediatrician for a career

1 answer
Question:

Write an essay about choosing Pediatrician for a career

Answers

Answer:Many people in this world want to make a difference in life. However, most people do not want to put in all the effort that it takes to do so. The job of a pediatrician is life-changing to many. Unfortunately, it takes drive and effort that many people do not have, to become a pediatrician. A pediatrician’s job is a highly-skilled and interesting job because he or she has the privilege to deal with and help as many children as possible. What is a pediatrician? Pediatricians are doctors who specialize and focus in caring for babies to young adults (Career Cruising). They deal with childhood diseases and the care of infants with health and sickness (Elberts). The typical upper age limit of patients is from age twelve to age…show more content…Most pediatricians start in the morning around 9:00 A.M. However, they have to come in a little earlier to get ready for the day (Holycross). A current pediatrician, Julie Holycross, stated that she prints out lists and growth charts, downloads labs, and also does assessments to make sure her patients meet their milestone. Where does the word “Pediatrician” come from? The Greek words pais and iatros mean child and doctor of healer. Pediatrics is a cognate that means healer of children (NetMed Pediatrics).Explanation:

Similar Solved Questions

2 answers

•¿Should undocumented immigrants be allowed to remain in the US? UU. ? •AND AN and introduction WHY AND ALSO YOU SAY YES OR NO ​

•¿Should undocumented immigrants be allowed to remain in the US? UU. ? •AND AN and introduction WHY AND ALSO YOU SAY YES OR NO ​...
2 answers

20=5x+10y will give brainiest if solved in the next 5 min

20=5x+10y will give brainiest if solved in the next 5 min...
1 answer

The length of a rectangle is twice the width. the perimeter is 90 inches. what is the rectangles area? you write the equation 2w+2w+w+w=90 for the word problem. you solve and get 15. what is the answer to the problem?A) The area is 450 in^2B) The width is 15 inches.C) The area is 112.5 in^2D) The length is 30 inches.​

the length of a rectangle is twice the width. the perimeter is 90 inches. what is the rectangles area? you write the equation 2w+2w+w+w=90 for the word problem. you solve and get 15. what is the answer to the problem?A) The area is 450 in^2B) The width is 15 inches.C) The area is 112.5 in^2D) The le...
1 answer

Where can you get a job in welding and what are the basic requirements?

Where can you get a job in welding and what are the basic requirements?...
1 answer

What kind of exercise is marathon ?

What kind of exercise is marathon ?...
2 answers

Find x please! :) pleaseeee

find x please! :) pleaseeee...
1 answer

What's the answer?????...??.???

what's the answer?????...??.???...
1 answer

Why did the pilgrims want to escape England and establish their own colony?

Why did the pilgrims want to escape England and establish their own colony?...
2 answers

Which of the following is a sentence fragment A. Marina is a fast runner and a skilled basketball player. B. Marina, an excellent basketball player C. Marina has very strong basketball skills. D. Marina, a great basketball player, scored 26 points today.

Which of the following is a sentence fragment A. Marina is a fast runner and a skilled basketball player. B. Marina, an excellent basketball player C. Marina has very strong basketball skills. D. Marina, a great basketball player, scored 26 points today....
1 answer

Help me pleaseeee:(((

Help me pleaseeee:(((...
1 answer

Find the domain of y=4√4x+2 a) x ≥ 1/2 b) x > 1/2 c) x ≥ -2 d) x ≥ -1/2

find the domain of y=4√4x+2 a) x ≥ 1/2 b) x > 1/2 c) x ≥ -2 d) x ≥ -1/2...
2 answers

In the illustration below the darkest part of the earth is experiencing A) winter B) summer C)day D) night

In the illustration below the darkest part of the earth is experiencing A) winter B) summer C)day D) night...
2 answers

How many unique solutions are there to the system of equations below? x+3y=7 -2x-6y=1 a zero b one c two d infinite

How many unique solutions are there to the system of equations below? x+3y=7 -2x-6y=1 a zero b one c two d infinite...
1 answer

16% of what number is 14?

16% of what number is 14?...
1 answer

How did henry the navigator for filled his mission

How did henry the navigator for filled his mission...
1 answer

Write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC...
1 answer

How do you recognize empathy? Please explain

How do you recognize empathy? Please explain...
1 answer

Which mineral is softer than fluorite

which mineral is softer than fluorite...
2 answers

Simplify (-8.5)(-5)( -2).​

simplify (-8.5)(-5)( -2).​...
1 answer

Rewrite the expressions as a multiple of a sum of two numbers with no common factor 15+33

Rewrite the expressions as a multiple of a sum of two numbers with no common factor 15+33...

-- 0.014220--