Solve the equation 8x-4=2(4x-4)

1 answer
Question:

Solve the equation
8x-4=2(4x-4)

Answers

Answer:Distribute8−4=2(4−4)8x-4={\color{#c92786}{2(4x-4)}}8x−4=2(4x−4)8−4=8−88x-4={\color{#c92786}{8x-8}}8x−4=8x−82Add 444 to both sides of the equation8−4=8−88x-4=8x-88x−4=8x−88−4+4=8−8+48x-4+{\color{#c92786}{4}}=8x-8+{\color{#c92786}{4}}8x−4+4=8x−8+43SimplifyAdd the numbersAdd the numbers8=8−48x=8x-48x=8x−42 more stepsResult0=−40=-40=−4The input is a contradiction: it has no solutions

Similar Solved Questions

2 answers

What is 4 percent of 74 ?

What is 4 percent of 74 ?...
1 answer

An example of a capital budgeting decision is deciding: Multiple Choice 1. how much money should be kept in the checking account. 2. whether or not to purchase a new machine for the production line. 3. how many shares of stock to issue. 4. how to refinance a debt issue that is maturing. how much inventory to keep on hand.

An example of a capital budgeting decision is deciding: Multiple Choice 1. how much money should be kept in the checking account. 2. whether or not to purchase a new machine for the production line. 3. how many shares of stock to issue. 4. how to refinance a debt issue that is maturing. how much inv...
2 answers

Which idea do the authors of both "Moving to America" and "A Fateful Journey include?

Which idea do the authors of both "Moving to America" and "A Fateful Journey include?...
2 answers

Read the quotation from chapter 5 of The Adventures of Huckleberry Finn. “Well, I'll learn her how to meddle. And looky here—you drop that school, you hear? I'll learn people to bring up a boy to put on airs over his own father and let on to be better'n what HE is.” What is Twain’s most likely intention for employing humor within this quotation?

Read the quotation from chapter 5 of The Adventures of Huckleberry Finn. “Well, I'll learn her how to meddle. And looky here—you drop that school, you hear? I'll learn people to bring up a boy to put on airs over his own father and let on to be better'n what HE is.” What is Twain’s most lik...
1 answer

In at least 150 to 200 words, explain how language was transmitted and evolved? Help please and fast !!

In at least 150 to 200 words, explain how language was transmitted and evolved? Help please and fast !!...
1 answer

Physicist use models to work out the pressure inside an aeroplane. The length of a model aeroplane is 16 cm and the length of the real aeroplane is 60 m. Work out the ratio of the length of the model to the real aeroplane..

Physicist use models to work out the pressure inside an aeroplane. The length of a model aeroplane is 16 cm and the length of the real aeroplane is 60 m. Work out the ratio of the length of the model to the real aeroplane.....
1 answer

During its first year of operations, Sarasota Corp. had these transactions pertaining to its common stock. Jan. 10 Issued 26,400 shares for cash at $6 per share. July 1 Issued 57,000 shares for cash at $7 per share. a) Journalize the transactions, assuming that the common stock has a par value of $6 per share. b) Journalize the transactions, assuming that the common stock is no-par with a stated value of $1 per share

During its first year of operations, Sarasota Corp. had these transactions pertaining to its common stock. Jan. 10 Issued 26,400 shares for cash at $6 per share. July 1 Issued 57,000 shares for cash at $7 per share. a) Journalize the transactions, assuming that the common stock has a par value of $...
1 answer

If you're not satisfied with your fitness evaluation score, there's really little you can do about it. Please select the best answer from the choices provided ОТ OF

If you're not satisfied with your fitness evaluation score, there's really little you can do about it. Please select the best answer from the choices provided ОТ OF...
2 answers

What means stay passive

what means stay passive...
1 answer

How did the Fugitive Slave Act of 1793 affect the kidnapping of free blacks and selling them into slavery?

How did the Fugitive Slave Act of 1793 affect the kidnapping of free blacks and selling them into slavery?...
1 answer

Number 9 based on the diagram above

Number 9 based on the diagram above...
1 answer

The picture shows a periodic table with elements X and Y. If the atomic number of element X is 3, then what is the atomic number of element Y? A. 5 B. 7 C. 19 D. 25

The picture shows a periodic table with elements X and Y. If the atomic number of element X is 3, then what is the atomic number of element Y? A. 5 B. 7 C. 19 D. 25...
1 answer

Simplify using the distributive property.8(y + 12)8y=1220y20 - y8y + 96​

Simplify using the distributive property.8(y + 12)8y=1220y20 - y8y + 96​...
2 answers

At what point does desire turn into greed?

At what point does desire turn into greed?...
1 answer

Solve for b 2/3+5=20-b

Solve for b 2/3+5=20-b...
1 answer

State the slope and the y-intercept for the graph of each equation. 1. y = x + 1 2. y = 2x – 4. 3. y = 1 x - 1 please help :((

State the slope and the y-intercept for the graph of each equation. 1. y = x + 1 2. y = 2x – 4. 3. y = 1 x - 1 please help :((...
2 answers

Reteaching with practice lesson 8.5 answers

Reteaching with practice lesson 8.5 answers...
1 answer

The volume of a lacrosse ball is what percent of the volume of a basketball?

The volume of a lacrosse ball is what percent of the volume of a basketball?...
1 answer

All of the adults in Bruno's life - Mother, Father, Maria, Pavel - choose not to explain to Bruno exactly what is going on at this new house in "Out-With" when they have the opportunity? Why do you think they are keeping the truth from him? Do you agree with their choice? Why or why not? Explain in at least 5 sentences.

All of the adults in Bruno's life - Mother, Father, Maria, Pavel - choose not to explain to Bruno exactly what is going on at this new house in "Out-With" when they have the opportunity? Why do you think they are keeping the truth from him? Do you agree with their choice? Why or why not? Explain in...
1 answer

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT...

-- 0.011254--