In the 1930s and 1940s, mario bauzá and john birks "dizzy" gillespie combined jazz with ____ to create new, interesting musical sounds and textures that have strongly influenced jazz music to this day.
1 answer
Question:
In the 1930s and 1940s, mario bauzá and john birks "dizzy" gillespie combined jazz with ____ to create new, interesting musical sounds and textures that have strongly influenced jazz music to this day.
Answers
Similar Solved Questions
1 answer
In his search for the elusive memory trace karl lashley finally concluded that memory was _____ the brain.
In his search for the elusive memory trace karl lashley finally concluded that memory was _____ the brain....
1 answer
How are each of the layers of the atmosphere separated?
How are each of the layers of the atmosphere separated?...
2 answers
A classroom globe has a diameter of 12 inches. What is the volume of the globe? Use 3.14 for pi. Round your answer to the nearest hundredth. 904.32 in3 2144.66 in3 7238.23 in3 9202.77 in3
A classroom globe has a diameter of 12 inches. What is the volume of the globe? Use 3.14 for pi. Round your answer to the nearest hundredth.
904.32 in3
2144.66 in3
7238.23 in3
9202.77 in3...
1 answer
Genetic Engineering in Bacteria. Human DNA is spliced into the _______, which is a small ring of DNA in bacteria. The _________ takes up the plasmid. It now contains the human gene. The bacterial cell reproduces the _____________ that the human gene codes for.
Genetic Engineering in Bacteria. Human DNA is spliced into the _______, which is a small ring of DNA in bacteria. The _________ takes up the plasmid. It now contains the human gene. The bacterial cell reproduces the _____________ that the human gene codes for....
1 answer
Select ALL that apply. The kidneys _____. - filter waste from the blood - reabsorb nutrients from the blood - ensure the body is hydrated - oxygenate the blood
Select ALL that apply.
The kidneys _____.
- filter waste from the blood
- reabsorb nutrients from the blood
- ensure the body is hydrated
- oxygenate the blood...
1 answer
To exercise, Ana goes up and down a ladder. She starts at the sixth step and walks as follows: up 3 steps, down 4 steps, up 2 steps, down 3 steps. On what step does she end up?
To exercise, Ana goes up and down a ladder. She starts at the sixth step and walks as follows: up 3 steps, down 4 steps, up 2 steps, down 3 steps. On what step does she end up?...
1 answer
Change .075 to a common fraction or a mixed number in lowest terms.
Change .075 to a common fraction or a mixed number in lowest terms....
1 answer
30 points! Karol works for a company that handles safety issues with nuclear power plants. She has grown nervous recently as she has learned that even though her country's nuclear power plants have effective safety measures in place, those in the neighboring country are not nearly as safe. How does the Chernobyl disaster prove that she is right to be concerned about her own country? Please answer ASAP. A. The disaster caused deformities, cancers, and other long-term illnesses. B. The disaster c
30 points!
Karol works for a company that handles safety issues with nuclear power plants. She has grown nervous recently as she has learned that even though her country's nuclear power plants have effective safety measures in place, those in the neighboring country are not nearly as safe. How does...
2 answers
Hey, Would someone help me on this. Thanks xx... Here are 4 digits: 6 3 5 9 Using only 3 of the digits write a number that is closest to 600. You can only use each of the digit once . GCSE MATHS NUMBER QUESTION
Hey, Would someone help me on this. Thanks xx... Here are 4 digits: 6 3 5 9 Using only 3 of the digits write a number that is closest to 600. You can only use each of the digit once . GCSE MATHS NUMBER QUESTION...
1 answer
Convert 7.80 quarts into milliliters. Show your work, include units with every number, and round your answer to the correct number of significant figures.
Convert 7.80 quarts into milliliters.
Show your work, include units with every number, and round your answer to the
correct number of significant figures....
1 answer
3. Emilio is going to run 6 miles a day for 8 days. How many miles will he have completed altogether by the end of the 8th day?
3. Emilio is going to run 6 miles a day for 8 days. How many miles will he have completed
altogether by the end of the 8th day?...
1 answer
Which 3 major catastrophes struck Europe prior to the Protestant Reformation?
Which 3 major catastrophes struck Europe prior to the Protestant Reformation?...
2 answers
Hillary's sister does not practice as much as _____ .
Hillary's sister does not practice as much as _____ ....
1 answer
3x ^ 3 - 5x ^ 2 + x and 4x ^ 3 + 2x ^ 2 - 4x
3x ^ 3 - 5x ^ 2 + x and 4x ^ 3 + 2x ^ 2 - 4x...
1 answer
The bold adjective describes which noun? The tiny butterfly landed in the quiet garden across from Gandalf s house.
The bold adjective describes which noun?
The tiny butterfly landed in the quiet garden across from Gandalf s house....
2 answers
Excerpt from The Right Decision Lindsay Rock (1) Timothy remained on the deck long after England had become but a speck on the horizon. (2) When darkness fell, he retired to the cramped quarters in steerage—the lowest passenger area with the fewest accommodations—and tried to make himself comfortable on a hard bunk bed with a thin, straw mattress. (3) Around him, mothers tried to keep their babies quiet and fathers told stories to tired kids. (4) For a long time, the hum of the ship's engine, th
Excerpt from The Right Decision
Lindsay Rock
(1) Timothy remained on the deck long after England had become but a speck on the horizon. (2) When darkness fell, he retired to the cramped quarters in steerage—the lowest passenger area with the fewest accommodations—and tried to make himself comfor...
1 answer
Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base. Original DNA gene: GATCGATACCATTCGGCGCATACTTCG A)The mutated DNA sequence; highlight the insertion mutation. B)The resulting MRNA sequence for each mutation: C) The resulting amino acid sequence for each mutation (you will need the codon wheel chart for this): Note: Begin translation at the first start codon, AUG, that you see when reading th
Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. Randomly insert a base.
Original DNA gene: GATCGATACCATTCGGCGCATACTTCG
A)The mutated DNA sequence; highlight the insertion mutation.
B)The resulting MRNA sequence for eac...