Google’s adwords system provides a quality score as a measure of _____, which indicates the usefulness of an ad message to consumers doing a google search.

1 answer
Question:

Google’s adwords system provides a quality score as a measure of _____, which indicates the usefulness of an ad message to consumers doing a google search.

Answers

The term that best fit the blank is RELEVANCE. The Google Adwords system is a system that is created by Google for the purpose of advertising online. Therefore, relevance is very important in this aspect as this shows how useful the ad is to the consumers who are doing the google search.

Similar Solved Questions

2 answers

Sounds are affected by ... and ...A. frequency , vibrations B. temperature, determines C. sonar, ultrasound D. noise, vibrations​

Sounds are affected by ... and ...A. frequency , vibrations B. temperature, determines C. sonar, ultrasound D. noise, vibrations​...
1 answer

Energy released from atomic reactions is called?

energy released from atomic reactions is called?...
1 answer

WXYZ is an isosceles trapezoid with legs WX and YZ and a base XY. If the length of WX is 6x+5, the length of XY is 10x+4 and the length of YZ is 8x-3, find the value of x.

WXYZ is an isosceles trapezoid with legs WX and YZ and a base XY. If the length of WX is 6x+5, the length of XY is 10x+4 and the length of YZ is 8x-3, find the value of x....
1 answer

When John Law's Mississippi Bubble burst he was chased in the streets and stoned. Question 5 options: True False

When John Law's Mississippi Bubble burst he was chased in the streets and stoned. Question 5 options: True False...
2 answers

−4(2x+5)+2x+3= −11 what is x

−4(2x+5)+2x+3= −11 what is x...
2 answers

Help me please I need help with this

Help me please I need help with this...
2 answers

Treaty of Versailles List who the big 3 were, what country they represented in and what they wanted to achieve​

Treaty of Versailles List who the big 3 were, what country they represented in and what they wanted to achieve​...
1 answer

Another question for today help me plz And plz give me brainlyest

Another question for today help me plz And plz give me brainlyest...
1 answer

One of the satellites of Pluto has an orbit like _____. the satellites of Jupiter the Earth's moon the satellites of Uranus Titan

One of the satellites of Pluto has an orbit like _____. the satellites of Jupiter the Earth's moon the satellites of Uranus Titan...
1 answer

Which was a factor in the creation of secret societies among the forest peoples? Bitter rivalries within kinship networks hindered conflict resolution. Community members wanted to own and cultivate their property. Food distribution in communities favored the chief’s family. Merchants needed extra protection when dealing with foreign traders.

Which was a factor in the creation of secret societies among the forest peoples? Bitter rivalries within kinship networks hindered conflict resolution. Community members wanted to own and cultivate their property. Food distribution in communities favored the chief’s family. Merchants needed extra ...
1 answer

What did the autobiography of olaudah equiano reveal about slavery in the caribbean and north america? a)slaves were beaten, had poor living conditions, and worked long hours. b)children of slaves were born free and had many legal rights. c)owners could not afford to maintain their slaves in a healthy condition. d)ultimately, slavery became a money-losing proposition for slave

what did the autobiography of olaudah equiano reveal about slavery in the caribbean and north america? a)slaves were beaten, had poor living conditions, and worked long hours. b)children of slaves were born free and had many legal rights. c)owners could not afford to maintain their slaves in a healt...
1 answer

Describe the difference between the Spanish American colonies and the North American colonies with regard to race, social, and economic status.

Describe the difference between the Spanish American colonies and the North American colonies with regard to race, social, and economic status....
2 answers

Which statement accurately describes the chemical symbol of an element?

Which statement accurately describes the chemical symbol of an element?...
1 answer

Evaluate the expression. 9.(13)

Evaluate the expression. 9.(13)...
1 answer

3 facts about about argumentative persuasive writing​

3 facts about about argumentative persuasive writing​...
1 answer

How did the cowboy's life similar from the myth about it

how did the cowboy's life similar from the myth about it...
1 answer

Write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC

write the code for RNA from this DNA STRAND : AAAAAATTTTTTCCCGGGGTTTATATATC...
2 answers

7. Which layer(s) is liquid?(There may be more than one correct answer so select all that you think are correct)(1 Point)MantleOuter CoreCrustInner Core​

7. Which layer(s) is liquid?(There may be more than one correct answer so select all that you think are correct)(1 Point)MantleOuter CoreCrustInner Core​...
1 answer

Using compatible numbers to estimate the quotient 358/3

Using compatible numbers to estimate the quotient 358/3...

-- 0.012916--