Daniel made a bench that has a seat with an area of 16 square ft the length and the width of the seat are whole numbers the length is 4 times greater than the width what are the dimensions of the seat select the length and width A. 2 ft B. 4 ft C. 6 ft D.8 ft E.16 ft
1 answer
Question:
daniel made a bench that has a seat with an area of 16 square ft the length and the width of the seat are whole numbers the length is 4 times greater than the width what are the dimensions of the seat select the length and width A. 2 ft B. 4 ft C. 6 ft D.8 ft E.16 ft
Answers
Answer: The width is option (A) 2 ft and the length is option (D) 8 ftStep-by-step explanation: The bench has been constructed and we have been given the area as 16. So we already know thatArea = L x W16 = L x WAlso we have been given that the length is 4 times greater than the width. This means if the width is W, then the length would be 4 time W, which is 4W.Therefore, having known the area as 16 square feet, the equation becomes;16 = 4W x W16 = 4W²We add the square root sign to both sides of the equation and we have√16 = √4W²4 = 2WDivide both sides of the equation by 2,2 = WWith the width now known as 2 ft, the length which had been determined as 4W now becomesLength = 4(2)Length = 8Therefore, the length is 8 ft, and the width is 2 ft.
Similar Solved Questions
1 answer
Each week Suzanne and Sarah drink 2 gallons of milk.HGow many iounces of milk do they drink each Week ?
Each week Suzanne and Sarah drink 2 gallons of milk.HGow many iounces of milk do they drink each Week ?...
1 answer
When a polynomial x^3-ax^2-2x+2a+6 leaves a remainder (a+2) when divided by (x-a), find the value of a.
when a polynomial x^3-ax^2-2x+2a+6 leaves a remainder (a+2) when divided by (x-a), find the value of a....
1 answer
Witch external proved to be the greatest continuing threat to the Byzantine empire in the 15 th century?
witch external proved to be the greatest continuing threat to the Byzantine empire in the 15 th century?...
1 answer
Survey on televisions requiring repairs within four years was conducted. Nineteen out of 200 televisions from company A and 25 out of 200 televisions from company B needed repairs. Do these data show that televisions from company A are more reliable than televisions from company B?
survey on televisions requiring repairs within four years was conducted. Nineteen out of 200 televisions from company A and 25 out of 200 televisions from company B needed repairs. Do these data show that televisions from company A are more reliable than televisions from company B?...
2 answers
Read the excerpt from "Bone Detective." Diane stood in front of a mirror and stuck out her tongue. It looked like a rosy pink welcome mat to her delicate insides. Her usual rubber mold formula was out of the question—too toxic. She wondered, What is safe to swallow, fast and easy to apply, and hardens quickly into a firm mold? One of her horse-riding pals, a veterinarian named Mary Wright, had the answer: alginate. Mary told Diane that alginate was a pink gummy material used to make molds of tee
Read the excerpt from "Bone Detective."
Diane stood in front of a mirror and stuck out her tongue. It looked like a rosy pink welcome mat to her delicate insides. Her usual rubber mold formula was out of the question—too toxic. She wondered, What is safe to swallow, fast and easy to apply, and har...
1 answer
Based on the following data, what is the quick ratio, rounded to one decimal point? Accounts payable $ 30,000 Accounts receivable 60,000 Accrued liabilities 5,000 Cash 30,000 Intangible assets 50,000 Inventory 69,000 Long-term investments 80,000 Long-term liabilities 100,000 Marketable securities 30,000 Fixed assets 670,000 Prepaid expenses 1,000 3.0 1.8 2.2 3.4
Based on the following data, what is the quick ratio, rounded to one decimal point? Accounts payable $ 30,000 Accounts receivable 60,000 Accrued liabilities 5,000 Cash 30,000 Intangible assets 50,000 Inventory 69,000 Long-term investments 80,000 Long-term liabilities 100,000 Marketable securities 30...
2 answers
How do McCarthy’s references to Abraham Lincoln at the beginning and end of his speech support his argument?
How do McCarthy’s references to Abraham Lincoln at the beginning and end of his speech support his argument?...
2 answers
A computer program that enables users to create and work with files and folders is called what? a web browser a file manager a user interface a file reader
A computer program that enables users to create and work with files and folders is called what?
a web browser
a file manager
a user interface
a file reader...
1 answer
What event introduced a latin-based vocabulary into english?
What event introduced a latin-based vocabulary into english?...
1 answer
Olivia is tracking the growth rate of a population of termites, x, living in a mound. When the population is x = 400, it is the 0th hour. Initially, it takes f(x) = 1 hour for the population to grow by 400 termites. When the population grows by another 400 termites, the total time taken is f(x) = 1.585 hours. The time taken keeps decreasing to model the same incremental growth. Does the equation for f(x) or the graph of g(x) correctly model the situation?
Olivia is tracking the growth rate of a population of termites, x, living in a mound. When the population is x = 400, it is the 0th hour. Initially, it takes f(x) = 1 hour for the population to grow by 400 termites. When the population grows by another 400 termites, the total time taken is f(x) = 1....
1 answer
Does beowulf consider that he might die in his battle with grendel
Does beowulf consider that he might die in his battle with grendel...
1 answer
Which of the following is not an example of a multichannel retailer?
Which of the following is not an example of a multichannel retailer?...
1 answer
Please help me with this. No links or random words or I will report.
Please help me with this. No links or random words or I will report....
1 answer
9. ¿Cómo se le nombra a la forma de concebir el mundo y el universo que tenían los pue- blos del México antiguo?
9. ¿Cómo se le nombra a la forma de concebir
el mundo y el universo que tenían los pue-
blos del México antiguo?...
2 answers
Which of the following is NOT an example of digital media? O a. An animated game played on a game console O b. A video chat played on a laptop OC. A podcast played on a smartphone d. A song played on an electric guitar
Which of the following is NOT an example of digital media?
O a. An animated game played on a game console
O b. A video chat played on a laptop
OC. A podcast played on a smartphone
d. A song played on an electric guitar...
1 answer
Lucy and Fred want to begin saving for their baby's college education. They estimate that they will need $120,000 in eighteen years. If they are able to earn 7% per annum, how much must be deposited at the end of each of the next eighteen years to fund the education
Lucy and Fred want to begin saving for their baby's college education. They estimate that they will need $120,000 in eighteen years. If they are able to earn 7% per annum, how much must be deposited at the end of each of the next eighteen years to fund the education...
1 answer
What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT...
2 answers
What is the executive branch responsible for?
What is the executive branch responsible for?...